Overblog Suivre ce blog
Editer l'article Administration Créer mon blog
1 août 2010 7 01 /08 /août /2010 14:45

 

Généalogie génétique, cette association est nouvelle et consacre l'émergence d'une nouvelle discipline. Il y a 2 pôles : la compréhension du peuplement actuel en liaison avec la théorie "Out of Africa" (discussion à suivre) qui met en jeu les marqueurs dits SNP (Single Nucleotide Polymorphism) , et le prolongement de la recherche généalogique, là où les documents écrits viennent à manquer, par des comparaisons génétiques qui mettent en jeu les marqueurs dits STR (Short Tandem Repeats) ; c'est cette dernière facette, la plus pratiquée par le grand public, qui donne le nom de Généalogie génétique. Ceci dit, le développement en France reste confidentiel si on compare aux pays anglo-saxons et c'est un problème car les résultats intéressants sont directement proportionnels à la taille de la banque de donnée qui permet les comparaisons d'haplotypes (définition à suivre).

 

1 – Le modèle « Out of Africa » - principe de l'utilisation du chromosome Y

 

Le chromosome Y est particulier car il n'est présent qu'en 1 seul exemplaire et seulement chez les hommes (qui ont XY comme chromosomes sexuels, alors que les femmes sont XX). Il a été montré que sur une grande partie ce chromosome Y ne recombine pas avec le chromosome X , alors que, par exemple , le chromosome X va être l'objet de recombinaisons entre les 2 copies présentes chez les femmes. Donc le chromosome Y est transmis de père en fils , un peu comme un bâton de relais et c'est le seul chromosome dans ce cas puisque de nombreux mélanges (recombinaisons) ont lieu sur les autres chromosomes. Ceci dit des mutations peuvent se produire ; le suivi de ces mutations va permettre d'identifier des groupes humains ayant les mêmes mutations sur le chromosome Y et cette approche est en train de révolutionner notre compréhension de l'histoire de l'homme.

Que sont ces mutations qui sont suivies sur le chromosome Y ? On distingue 2 types de mutations et, pour l'instant nous ne nous intéresserons qu'aux mutations ponctuelles dites SNP. Une mutation ponctuelle sur le chromosome Y a peu de chances de modifier une fonction vitale et celles utilisées sont des mutations neutres ne modifiant le produit d'aucun gène. Dans ce qui suit il ne faut donc pas envisager que les mutations invoquées ont un effet repérable : ce sont des marqueurs génétiques et donc uniquement des moyens de comparer des populations. Une mutation ponctuelle ne se produit que rarement et il est très peu probable que la même mutation se produise dans 2 lignées . Donc une même mutation va repérer des hommes ayant eu une origine commune.

 

Je prends comme exemple le marqueur M168 : tous les hommes issus de populations non africaines ont cette mutation et seuls certains groupes africains ne l'ont pas ; ce sont, par exemple, les Pygmées et les Bushmen . On a déduit de cette situation que Homo sapiens a d'abord été africain. M168 nous dit que la sortie d'Afrique a été le fait d'un groupe d'hommes ayant cette mutation : c'est le modèle « Out of Africa » . La sortie d'Afrique en question serait la dernière vague, celle de l'homme actuel et ceux ci ont pris la place des populations homo précédentes. Le point important est que cette sortie d'Afrique est relativement récente – environ 70 000 ans. Pour ceux qui souhaitent approfondir voici quelques informations sur la façon dont on caractérise une telle mutation. Toute mutation identifiée reçoit un premier « nom » , dans ce cas rs2032595. Cette mutation lorsqu'elle a été citée pour « out of Africa » a reçu un nom usuel : M168 .

M168 = rs2032595 C--> T position 13323385

Ce qui précède se lit : M168, initialement rs2032595 à la position 13323385 sur le chromosome Y ; il y a normalement un C ( Cytosine) , situation ancestrale, et ceux ayant la mutation M168 ont un T (Thymine) à la place du C. On pourrait penser que la situation la moins fréquente (Pygmées) est la situation « mutée » et qu'il faudrait inverser la lecture. Il y a encore des débats sur ce point mais l'arbre génétique qu'on peut déduire de l'ensemble des mutations connues et la comparaison avec le génôme du Chimpanzé vont dans le sens de lecture « Out of Africa » : les Pygmées et les Bushmen ont conservé l'ADN ancestral et les autres populations descendent du groupe « mutant » , sans doute porteur d'un progrès technique qui a permis cette sortie d'Afrique .

 

 

2- L'ADN mitochondrial comme outil pour la génétique :

 

Les mitochondries présentes dans le cytoplasme de nos cellules (hommes et femmes) contiennent un ADN circulaire de 16570 nucléotides, donc beaucoup plus petit que le chromosome Y mais c'est suffisant pour les études génétiques et, dans un premier temps, cette petite taille a facilité le travail des scientifiques ; c'est ainsi que les premiers résultats ont été obtenus sur l'ADN mitochondrial. Il se trouve que les mitochondries ne sont pas transmises par les spermatozoïdes ; les mitochondries des cellules de nos enfants sont celles de leur mère. Nous avons tous des mitochondries et nous les avons hérité de notre mère. La transmission mère fille de l'ADN mitochondrial permet d'analyser les populations de la même façon que dans le cas de la transmission père fils avec le chromosome Y. Le modèle Out of Africa se trouve conforté par le fait que les groupes L0 , L1 et L2 sont africains alors que toutes les autres populations sont des descendants (sous groupes) du groupe L3. On peut imaginer un groupe humain porteur d'un ADN-Y avec la mutation M168 et un mtDNA L3 dont la plupart des groupes humains actuels sont issus. Il est aujourd'hui possible de séquencer entièrement l'ADN mitochondrial et c'est la seule bonne façon de comparer. Une compagnie propose à des prix acceptables un tel séquençage pour des particuliers. L'ordre de grandeur est de 10 000 mtDNA dans le monde séquencés, et donc une base de données qui est maintenant très convenable.

 

 

3- L' Abre Y :

 

Y

•       A   M91 Afrique

•       BT    SRY10831.1

•      •       B   M60 Afrique

•      •       CF    M168

•      •       •      DE    YAP

•      •       •      •       D    M174 Tibet, Japon

•      •       •      •       E     M40 Afrique du nord , Afrique noire , Moyen orient

•      •       •      C,F   P143

•      •       •      •       C    M130 Asie (Mongolie) , Polynésie, Australie

•      •       •      •       F     M89

•      •       •      •      •       G     M201 Caucase, Europe , moyen orient

•      •       •      •      •       H    M69 Inde (+ Gitans)

•      •       •      •      •       IJK    M523

•      •       •      •       •      •       IJ   M429

•      •       •      •       •      •       •       I     M170 Europe

•      •       •      •       •      •       •       J     M304 Moyen orient , Europe

•      •       •      •       •      •       K     M9

•      •       •      •       •      •       •       L     M11 Inde

•      •       •      •       •      •       •       MNOPS    M526

•      •       •      •       •      •       •      •       M    P256    Nouvelle Guinée

•      •       •      •       •      •       •      •       NO    M214

•      •       •      •       •      •       •      •       •       N     M231 Sibérie , Finlande

•      •       •      •       •      •       •      •       •       O     M175 Asie (extrême orient - riz)

•      •       •      •       •      •       •      •       P     M45

•      •       •      •       •      •       •      •       •       Q     M242 Amérique

•      •       •      •       •      •       •      •       •       R     M207 Europe , Asie (Iran)

•      •       •      •       •      •       •      •       S    M230 Mélanaisie , Nouvelle Guinée (Papous)

•      •       •      •       •      •       •       T     M70 Afrique de l'Est, Inde , Europe

 

 

Toutes les mutations ont un nom usuel comme M168 car elles sont régulièrement citées comme marqueurs des groupes de cet arbre. M168 discutée ci-dessus apparaît à la ligne 4 pour définir le groupe [CF]. Les groupes A , [BT] et B sont uniquement africains. Le groupe [BT] est ancestral au groupe [CF] et donc la mutation SRY10831.1 est commune . En dessous de [CF] il y a deux cas :

  •  
    • le groupe [DE] se caractérise par un élément d'insertion « Alu » nouveau sur Y

    • les groupes C et F ont tous deux la mutation P143 en commun

Je ne vais pas décrire tout l'arbre. Les populations européennes sont principalement formées de sous groupes de F mais le groupe E est très répandu (venu d'Egypte) sur le pourtour méditerranéen , les Kabyles et de nombreux groupes arabes sont du groupe E . Comme le montre l'arbre pour le groupe F , on distingue plus précisément les grands groupes G , H et [IJK] ; ce dernier groupe se subdivise à son tour en I , J et K. Le groupe majoritaire en Europe de l'ouest est le groupe R descendant du groupe K et tous ceux du groupe R portent les mutations : M168, P143, M89, M523, M9, M526, M45 et M207 . La succession de ces mutations retrace , en quelque sorte, le périple génétique qui a mené au groupe R ; j'emprunte cette notion à Spencer Wells (« genetic journey ») créateur du projet Genographic. On a donc l'identification de groupes qu'on nomme haplogroupes car ils sont définis sur la base d'un seul chromosome (dans ce cas le chromosome Y) et ces groupes ont une répartition géographique en rapport avec les liens génétiques que révèle l'arbre, en général. Il y a quelques cas qui pose question : le groupe D qui partage avec le groupe E la présence du marqueur YAP est un groupe qu'on rencontre du Tibet au Japon ; le lien avec le groupe E fait supposer que le groupe DE originel était asiatique et que le groupe E a effectué un retour vers l'Afrique de l'Est mais ce point fait l'objet de discussions.

L'arbre ci-dessus retrace à grands traits les séparations qui ont jalonnées l'histoire de l'homme de ces 70 000 dernières années. Il est possible d'être plus précis : le groupe R se subdivise à son tour selon de nombreuses mutations (SNP) ; je ne détaille pas ici mais le groupe le plus fréquent en France est repéré par M168, P143, M89, M523, M9, M526, M45 et M207 (ceux là caractérisent R) , M173, M343, P25, P197, M269 (ces 5 mutations précisant le sous groupe R1b1b2) , L23, L51, L52, P310, P312, L21 (c'est un exemple – il y a d'autres sous groupes). On a donc une vingtaine de mutations

dont la succession (dans l'ordre où je les ai écrites) a conduit au groupe actuel . De nouveaux SNPs permettant de décrire plus finement les groupes (haplogroupes) continuent d'être identifiés.

 

4- Comment ces résultats ont-ils été obtenus ?

 

Les populations peuvent donc être réduites aux tribus dont nous sommes issus et l'organisation des SNPs en arbre permet de retrouver les filiations des groupes entre eux. Ces résultats ont été obtenus premièrement par les scientifiques et par tous les résultats accumulés des particuliers collectés dans des bases de données publiques. Je n'ai pas de contrat pour faire de la pub mais c'est un fait (souvent ignoré en France) que 2 compagnies font ces tests avec la qualité et la précision des laboratoires de recherche : Family Tree DNA (Igenea en Europe) et 23andME . Il y a 2 méthodologies différentes . Family Tree DNA amplifie la région du chromosome Y à analyser et et en établit la séquence ; on voit ainsi s'il s'agit de la séquence ancestrale ou de la forme mutée, il faut refaire une amplification et un séquençage à chaque fois qu'on veut tester un autre SNP. 23andME analyse avec une puce à ADN qui teste d'un seul coup tous les SNPs pour laquelle la puce a été prévue, donc tout l'arbre de tous les SNPs est obtenu en une étape ; c'est mieux mais un peu plus cher.

 

Tout un chacun peut ainsi connaître sa lignée paternelle et son origine. Il ne s'agit que d'une seule lignée parmi tous nos ancêtres . Cette approche se révèle très instructive au niveau des populations et la participation de particuliers a permis de « booster » ce champ de recherche. En France où nous avons très peu de tests faits par des particuliers nous n'avons pratiquement pas d'études SNPs, avec la précision que permettent 23andME ou Family Tree DNA , disponibles publiquement.

 

 

 

5- Les principaux groupes en France

 

On a quand même quelques informations sur les haplogroupes en France. Le groupe de G. Lucotte a été pionnier dans les études génétiques des populations mais ils utilisaient une analyse RFLP avec une sonde p49a,f qui n'est plus pratiquée aujourd'hui. On a donc une analyse, pas aussi fine que ce que permettent les SNPs connus maintenant mais quand même solide. Il y a les Canadiens français qui, eux, se font tester et les familles émigrées aux USA. On connaît donc, en gros, les groupes les plus importants en France ; on connaît moins les différences régionales. Par exemple on ne sait pas si la Normandie garde la trace des colons Normands (Vikings) et leur fréquence.

 

Les études portent, en général, sur des échantillons de personnes ayant une origine connue dans la région étudiée. Le groupe principal en France (environ 55% des hommes) est R1b1b2 discuté plus haut, groupe dont on connaît plusieurs sous groupes. L'haplogroupe I (la lettre i) est européen et on connaît 2 grands sous groupes I1 et I2 , anciennement séparés. Les 2 formes existent en France et la fréquence combinée des deux est autour de 15% . Je ne me risque pas à décrire la répartition entre les autres haplogroupes.

 

6- Les marqueurs STR

 

Les marqueurs STR (pour Short Tandem Repeat) sont connus en France sous le nom d'empreintes génétiques. Ce sont ces marqueurs qui permettent les identifications policières si souvent vues dans les séries à la télé et aussi dans la réalité. On trouve ces marqueurs sur tous les chromosomes et il y en a sur le chromosome Y ; ce sont ces derniers qui seront exclusivement utilisés pour conforter les analyses SNPs. Ce sont les mêmes marqueurs qui sont utilisés, par exemple, pour les recherches de paternité. Cette situation crée une ambiguïté regrettable sur la motivation d'un test STR .

Le marqueur DYS393 sera pris ici comme exemple ; voici comment se présente la séquence ADN au niveau du marqueur DYS393 (rappel le code ADN est la succession des 4 bases notées A, G, C et T) :

 

atacagatagatagatagatagatagatagatagatagatagatagatagatagatatgtatgt

 

ataca [gata]13 tgtatgt

 


La séquence ci-dessus montre une région formée par la succession de [gata] (13 répétitions). Dans l'exemple ci-dessus il y a 13 motifs [gata] qui se suivent « en tandem » d'où le nom que les anglo-saxons donnent à ces empreintes génétiques.  On observe que d'une génération à l'autre il peut y avoir perte où gain d'un motif [gata] et un tel changement se produit bien plus fréquemment qu'une mutation SNPs. C'est donc le nombre de répétitions du motif [gata] qui est repéré. La grande majorité des utilisateurs ne connaissent pas le motif des marqueurs qu'ils utilisent ; ce qui compte c'est le nombre de motifs.  Les taux de mutation ne sont  pas les mêmes. Il y a des marqueurs qui mutent très souvent (une fois toutes les 10 générations, par exemple) et des marqueurs qui mutent presque comme des marqueurs SNPs. Donc on mesure le nombre de répétitions et, dans l'exemple ci-dessus on note :  DYS393=13  et ainsi de suite pour les autres marqueurs . Le résultat combiné  de tous  les comptes de répétitions est un haplotype. C'est un peu comme un code barre avec une valeur (le nombre de motifs) pour chaque marqueur. Plus il y a de marqueurs plus l'haplotype sera spécifique. Il y a des banques de données  de ces haplotypes. Au sein d'un même haplogroupe les haplotypes seront semblables et cela permet de prédire l'haplogroupe à partir de l'haplotype (avec une incertitude – mieux vaut une véritable mesure) , par comparaison. C'est aussi la variabilité des haplotypes dans un groupe qui donne une mesure de « l'âge » du groupe. On dispose donc d'une panoplie d'outils qui permettent de bien appréhender les groupes humains par le biais de l'ADN-Y . Si le séquençage total de génôme progresse on pourra comparer des chromosomes Y en décuplant les marqueurs pour les comparaisons.

 

Partager cet article

Repost 0
Published by chezdidier.over-blog.com
commenter cet article

commentaires

Willy PORLIER 02/11/2010 19:59



Bonjour Didier ,


Le site DNA Forum ne semble être out ez ? as tu des infos ?


Merci par avance


 


Willy



Didier 03/11/2010 22:40



Ouais . je ne sais pas ce qui se passe mais c'est lourd. Comment c'est Eupedia ?


 



Autre Vue 02/08/2010 20:38



Bienvenue dans la communauté libre expression. J'avoue que votre blog est hors de mes compétences en génétique, je me suis arrêté à la carte de donneur d'organe et je ne pense pas que cela change
beaucoup la génétique de la personne qui recevra peut-être quelque chose de moi 



Didier 03/08/2010 01:53



Le don d'organe est réglé par les gènes du complexe HLA (compatibilité tissulaire) et le génotypage va révolutionner nos connaissances en facilitant et généralisant la connaissance de notre
génétique (HLA et autres). Je pense faire un prochain article sur le génotypage. A suivre



LADY MARIANNE 02/08/2010 14:38



bonjour et bienvenue dans ma communauté " forum libre expression "
merci de ton choix et de tes publications dans la commuanuté -
bien amicalement   Lady marianne
il te faudra aller dans configuration de ton blog - mettre en page - article et faire glisser le module communauté comme le module écrire un commentaire ( sous l'article )
un premier article assez hardu pour des non initiés -
si tu veux des visites je te conseillerais de ne pas faire trop pointu !!
si besoin contact en bas de mon blog

et une page d'accueil --- sexe-région -  merci



Didier 02/08/2010 16:52



Je ne sais pas comment  je dois faire quand je publie un nouvel article : est-ce qu'on communique par mail ?


 


Aujourd'hui j'ai décidé  de relayer l'information sur cet employé de TF1 licencié après avoir envoyé un mail à sa député au sujet de la loi Hadopi.