Overblog Suivre ce blog
Administration Créer mon blog
6 janvier 2012 5 06 /01 /janvier /2012 00:24

<!-- @page { margin: 2cm } P { margin-bottom: 0.21cm } -->


 

 

 

Cet article vise à actualiser ce qu'on peut trouver, en français, concernant l'origine du chien. Il se trouve que 2 articles scientifiques récents mettent le point final à une querelle de plus de 10 ans. Il restera des points à éclaircir mais l'essentiel semble acquis. L'équipe dirigée par Peter Savolainen aura eu raison. L'un des 2 articles mentionnés est le dernier article d'une série commencée en 2002 : « Origins of Domestic Dogs in Southern East Asia is supported by analysis of Y-Chromosome DNA » Zing et al. (2011). Le titre rappelle le point principal soutenu par Peter Savlainen : le chien est originaire de l'Asie du sud Est, c'est à dire la Chine du sud (sud du fleuve Yangtse). Je vais revenir sur les étapes de cette démonstration. L'autre article est une confirmation par une autre équipe : « Phylogenetic Distinctiveness of Middle Eastern and Southeast Asian Village Dog Y Chromosomes Illuminates Dog Origins » (2011) S.K. Brown et al.

Le séquençage du génome du chien a été publié en 2005. Avant cette date il n'était donc pas possible de travailler avec le chromosome Y puisqu'on ne connaissait ni SNPs ni STRs. Seul l'ADN mitochondrial pouvait permettre d'identifier des haplogroupes. Plusieurs thèses vont s'affronter car la collecte des échantillons, en particulier en Chine, n'a pas été facile. Il fallait des loups de différentes origines et des chiens d'origines les plus variées possibles. L'équipe de Savolainen a fait le bon choix en collaborant avec des scientifiques chinois . En 2002 sort l'article : « Genetic evidence for an East Asian origin of dogs » (2002) Savolainen P. et al. Il est établi que les chiens se regroupent en 6 groupes (haplogroupes) dont 3 seulement ont une réelle extension et ce n'est qu 'en Asie du sud Est qu'on trouve tous les groupes. Cette étude ne portait que sur 526 chiens et seule la région de l'ADN mitochondrial proche l'origine de réplcation et connue pour avoir un taux élevé de mutation, dite « région de contrôle », était étudiée. Un autre article plus complet fut publié en 2009 avec 1543 chiens étudiés dont 169 séquençages complets, ce qui permet une bien meilleure précision. L'étude confirme en tous points ce qui avait été publié en 2002 et précise que l'origine est au sud du fleuve Yangtse . Ces résultats étaient obtenus par l'ADN mitochondrial et donc la lignée femelle ; il restait la possibilité de croisements répétés ultérieurs avec des loups d'autres origines. Les analyses Y viennent de confirmer qu'on trouve de même que les chiens appartiennent à 5 haplogroupes et qu'on ne trouve les 5 groupes Y qu'en Asie du Sud Est.

Le chien est une domestication du loup. Les travaux décrits ci-dessus montrent que presque tous les chiens actuels descendent d'une domestication ayant eu lieu en Chine du sud. Il y a la possibilité que des domestications ultérieures aient eu lieu ; c'est ainsi que sont interprétés les groupes mineurs trouvés par Savolainen. Environ 98% des chiens sont originaires du sud Est asiatique. Il reste la possibilité que certains chiens soient issus d'autres événements de domestications. Les sites archéologiques ont révélés des restes anciens de canidés mais il est difficile de différencier loup et chien. J'insiste ici sur le fait qu'il est possible qu'il y ait eu des chiens issue d'une domestication séparée en Europe mais aucune des races conservées par les éleveurs du 19ème siècle (et avant) n'en descend . Il est possible que cette situation soit le pendant de ce qui semble s'être passé pour les humains : les agriculteurs sont venus avec leurs chiens et de même que les descendants de ces agriculteurs du moyen orient ont pris le pas sur les populations indigènes d'Europe (Cro Magnon) les chiens asiatiques ont pris le pas sur leurs analogues européens. Ceci dit, la migration depuis la Chine du sud reste un mystère car il n'y a pas de migration de groupes (haplogroupes) humains répertoriée de l'Asie du Sud Est vers le moyen orient puis l'Europe.

Savolainen, par des arguments de statistique, arrive à la conclusion que la domestication du loup en Asie du sud Est n'a pas concerné un seul couple mais une centaine de fondateurs, ce qui implique une véritable culture où les loups ont été apprivoisés. Par ailleurs, une datation approximative de cet événement aboutit à une date d'environ 15000 ans, ce qui, avec l'erreur importante liée à une telle estimation fait des domesticateurs de probables agriculteurs ou au moins des pasteurs. Les chiens obtenus à partir des loups de Chine du sud peuvent avoir eu des avantages, qui expliqueraient la rapide diffusion aux autres régions du monde.

 

 

Post Scriptum :

L'article Savolainen est de Z. Ding at al. et voici un lien :

http://www.nature.com/hdy/journal/vaop/ncurrent/full/hdy2011114a.html

 

Les auteurs suggèrent que les chiens ont été domestiqués en partie comme source de nourriture ; en période de disette les chiens pouvaient être tués et remplacés ensuite (à partir de loups locaux). Ceci pourrait expliquer pourquoi les groupes qui ont diffusé les chiens ailleurs dans le monde n'ont PAS continué à consommer les chiens ; il n'était pas possible de les remplacer et c'était sans doute un objet d'échange assez précieux. Le groupe humain responsable de cette diiffusion pourrait être le groupe Y  Q1, connu pour avoir largement colonisé les amériques et qui est aussi trouvé en Turque et en Inde (donc sur une très large étendue). Ce groupe n'est cependant pas de la Chine du sud. Le groupe Q1 pourrait donc avoir joué un rôle important dans la diffusion mais l'origine de la domestication revient sans doute à un autre groupe.

 

Repost 0
Published by Didier
commenter cet article
28 décembre 2011 3 28 /12 /décembre /2011 22:30

Le mot est lancé : tests génétiques . Déjà , on sait que les discussions seront âpres. C'est une tribune postée en octobre dernier et que je viens de trouver en faisant un tour d'horizon "google" des mots clé : "généalogie génétique" ( une façon de prendre le poul de ce qui s'écrit fin 2011) qui m'incite à faire cet article en vue d'une discussion plus large. La tribune postée ici :

http://www.rfgenealogie.com/s-informer/infos/nouveautes/loi-bioethique-revisee-rien-de-nouveau-sous-le-soleil-genealogique

a le mérite d'être bien pourvue en liens et de cibler le côté légal. Je vais donc suivre cette piste en prenant  le taureau par les cornes et en faisant le point des techniques et des enjeux.

Le législateur en France fait mine de considérer le cas des tests génétiques comme bien réglé et la modification de la loi sur la bioéthique sans évolution des textes sur les tests génétiques a été une façon  de revalider un texte obsolète sans en parler. Que dit la loi française ? Voici quelques liens utiles :

http://www.legifrance.gouv.fr/affichCodeArticle.do?idArticle=LEGIARTI000023711923&cidTexte=LEGITEXT000006070721

http://www.net-iris.fr/veille-juridique/actualite/27795/la-loi-bioethique-de-2011-adapte-aux-evolutions-de-la-societe-francaise.php

Je retiens 2 points de la loi : premièrement le texte de 2004 met en avant les "empreintes génétiques" , ensuite la loi bioéthique de 2011 fait mine d'avoir dépoussiéré en labelisant 2011 un texte qui n'est toujours pas plus précis et qui continue à cibler les dites empreintes sans mieux les définir.

 Il faut dès lors que je me lance dans une tentative d'explication de texte. En 2004, on pouvait comprendre sans trop d'ambiguités que le texte faisait référence à une avancée récente (en 2004) de nos connaissances du génôme. On a trouvé chez tous les organismes supérieurs, dont l'homme, des sites (nombreux) où l'ADN présente une  organisation répétée en tandem du type AGTCAGTCAGTCAGTCAGTC qui se lit (ici) [AGTC]5x. Il s'agit d'un exemple. Ces zones sont l'objet de mutations beaucoup plus fréquentes par perte ou gain d'un motif répété. Donc, il ne s'agit pas d'une mutation ponctuelle de l'ADN mais d'un "begaiement" de notre génétique. Il n'y a pas de fonction connue et il n'y a aucun gène touché : c'est tout à fait neutre vis à vis de nos fonctions vitales , dans notre compréhension actuelle. Ce sont ces mutations, mal comprises mais bien décrites, qui sont utilisées et nommées "empreintes génétiques". Présentes sur TOUS nos chromosomes elles permettent de faire des sortes de codes barres où chacun est repérable et où les filiations peuvent être prouvées (ou non). En 2004 c'était ça et seulement ça qui était visé. Cette méthode d'investigation est comme on le sait très utilisée par la police car on peut la pratiquer sur des traces infimes en amplifiant, préalablement à l'analyse, l'ADN des échantillons. En une dizaine d'années l'ADN est devnu incontournable ; on pouvait comprendre un certain émoi il y a encore 5 ou 6 ans et qu'il ait été relativement facile d'effrayer le badaud.

Où en sommes nous en 2011 ? Premier point, les évolutions dont je vais parler se font sans les compagnies et labos français qui sont en quelque sorte sur la touche . Il se trouve qu'en parallèle du développement des tests basés sur les "empreintes génétiques" on n'a pas vu venir les progrès du séquençage ADN . Aujourd'hui le projet "1000 genomes" a passé le cap des 2000 genômes (humains) entièrement séquencés :

voir : http://www.1000genomes.org/

 Je ne veux pas ergoter mais il me paraît impossible de lire sous "empreintes génétiques" la séquence complète d'un individu ! Or, des compagnies proposent déjà de tels séquençages car la technique avance à grand pas (pas en France encore une fois) et les tarifs chûtent. je renonce à mettre en ligne ici un lien mais il n'y a que le coût encore prohibitif pour un quidam moyen qui fasse barrage. L'automatisation a été un facteur déterminant et aujourd'hui il est possible à ceux qui ont les derniers robots de séquencer 1000 génomes par mois. je donne ces informations uniquement pour montrer une évolution rapide en marche. C'est dans ce contexte qu'on veut nous présenter un dépoussiérage sur l'air de "tout va très bien madame la marquise" ; d'où ce billet d'humeur. En gros, on va vers un séquençage complet pour une somme d'environ 5000 euros et une qualité acceptable. Ce n'est pas donné mais ça devient accessible à pas mal de revenus quand même ; non ?

 Sans aller jusqu'au séquençage total il est possible aujourd'hui pour 300 euros d'obtenir la séquence complète de son ADN mitochondrial. Je ne vois pas comment une personne qui se soit fait faire un tel séquençage total pourraît tomber sous le coup de la loi précitée sauf à torturer les mots et à leur faire dire n'importe quoi. L'un des points de cet article est de combattre l'idée reçue que toutes les analyses ADN sont interdites en France aux particuliers ; et le faire savoir.

 Une autre technique est née en 2008, plus exactement, elle est devenue accessible aux particuliers : l'analyse par puce ADN. le principe de la puce ADN est bien plus ancien mais l'application à l'analyse des gènes  par une compagnie dans un but de prédiction de risques est récente. le succès a été au rendez-vous au plan international, sous les quolibets des mêmes qui avaient empêché les tests génétiques en france. On cible des polymorphismes connus et ce qui fait débat c'est la qualité prédictive. Sans surprendre, je pense qu'on peut dire que si la qualité en 2008 était encore faible la situation change. Cette méthode d'analyse est clairement entrée dans la pratique grace à son coût durablement plus faible que le séquençage total. La puce proposée aujourd'hui teste 1 million de polymorphismes (pour environ 150 euros) et bientôt ce seront 2 millions de polymorphismes et une meilleure compréhension et analyse des résultats. Au passage, ces tests analysent le chromosome Y et l'ADN mitochondrial pour une analyse, non pas des empreintes génétiques mais des mutations ponctuelles qui ont jalonné les dernières 100 ou 200 générations et qui permettent aux scientifiques de définir des "haplogroupes" du chromosome Y (quand on suit les mutations apparues sur le chromosome Y) ainsi que les haplogroupes mitochondriaux. Ces tests par puce ADN ont permis, lorsqu'une banque de données suffisament importante existe d'identifier des parentés lointaines (cas de juifs, ou d'arméniens, par exemple).

 Peut être qu'en 2004 on pouvait douter et penser que le point de vue français aurait la vertu de modérer les tests et qu'on empêchait ainsi des débordements de la technique. J'accuse les promoteurs de ces dispositions d'avoir freiné tout développement sur l'ADN au niveau des laboratoires d'analyse ; je parle d'une activité de services et pas de 3 ou 4 labos pointus nécessaires aux analyses juridiques et policières. On ne peut pas continuer comme ça.






Poster un message



SPIP 2.0

Repost 0
Published by Didier
commenter cet article
10 août 2010 2 10 /08 /août /2010 21:47

Le Génotypage


J'ai été surpris par le manque d'information en français disponible sur le génotypage. Le parti pris va être d'éviter au maximum le vocabulaire « savant ». Même si c'est traité dans les lycées, le distingo génotype/phénotype sera évité. Il ne s'agit pas de se martyriser les méninges mais de comprendre la révolution en marche et ce que cela va changer. On utilise les tests génétiques déjà discutés et SNP signifie toujours « Single Nucleotide Polymorphism » .
La détermination d'une infection par un virus de type papillome demande l'analyse d'un frottis mais il va devenir possible et même préférable de faire une analyse ADN et de rechercher l'ADN de tous les virus connus. C'est en train de se mettre en place et c'est un progrès. Le résultat est non ambigu car le test ADN est très sensible et spécifique. On connaît au moins 200 génotypes du VPH (Virus du Papillome Humain), virus impliqué dans le cancer du col de l'uterus (entre autres).
De la même façon la recherche d'une contamination de type Légionellose (par exemple) va pouvoir se faire en recherchant l'ADN de la bactérie. Ces souches sont difficiles à cultiver et les cultures ne donnent des résultats qu'au bout d'un temps bien plus long qu'une analyse ADN. Le « suspens » sur la présence ou non de toxiques dans les huîtres (un classique) sera de courte durée .
Ce progrès touche aussi (bien sûr) l'ADN humain, c'est à dire la capacité à déterminer un caractère par un test ADN. Un exemple lié au virus du Sida. On s'est aperçu qu'une fraction de la population européenne (environ 5%) est porteur d'une délétion (segment d'ADN manquant) CCR5del32 et les porteurs sont protégés de l'infection par le virus du SIDA. Plusieurs compagnies proposent le test. En analysant l'ADN d'une personne on sait de mieux en mieux décrypter les informations, même si on en est encore aux premiers balbutiements.

Génotypage ABO :
Les gènes qui déterminent le groupe sanguin ABO , sont portés par le chromosome 9 et 23andME teste les 14 SNPs qui suivent (avec mes propres résultats) :

i4000505 ........ GG
rs8176749 ...... CC
i4000504 ...... ..CC
rs8176747 ...... CC
rs41302905 .... CC
rs8176746 ...... GG
rs8176745 ...... AG
rs8176743 ...... CC
rs8176740 ...... AT
rs7853989 ...... GG
rs1053878 ...... GG
rs2073824 ...... AG
rs8176719 ...... DD
rs512770 ........ AG

Rappel sur la lecture des données qui précèdent. Dans SNP il y a polymorphisme et il n'est donc pas surprenant que pour certains SNP comme rs512770 (le dernier de la liste) mon père et ma mère ne m'aient pas transmis le même allèle ; dans la paire de chromosome 9 j'en ai 1 avec rs512770 =A et l'autre avec rs512770 = G .
D signifie « Délétion » et I « Insertion ». C'est la délétion rs8176719=DD qui détermine le groupe O . Je suis donc du groupe O (confirmation d'un résultat que je connaissais déjà). Un allèle I (pour Insertion) comme rs8176719=ID ou rs8176719=I I , détermine un groupe A ou B selon le schéma qui suit . On remarque qu'on peut ainsi connaître son groupe sanguin plus précisément que A ou B et par exemple la lecture des résultats fait apparaître que j'ai 2 allèles O différents.
Dans ce qui suit les SNPs présentés ci-dessus sont alignés de gauche à droite ; le tiret pour le SNP rs8176745 indique que le résultat n'est pas pris en compte (par simplification). Donc, dans le cas où rs8176719=DD, c'est un groupe O, et dans tous les autres c'est soit A soit B , soit AB. Dans ces cas là on remarque que rs8176746 =G est un allèle A , et rs8176746 =T un allèle B.

Allèles A :
A101: G C C C C G – C A G G ? I G
A102: G C C C C G – C A G A ? I ?
A113: G C C C C G – C A C G ? I ?
A204: G C C C C G – T A C G ? I ?
A202: A C C C C G – C A G G ? I ?
A301: G C T C C G – C A G G ? I ?
Ax01: G C C C C G – C T G G ? I ?
Ael02: G C C C C G – C T G A ? I ?

Allèles B :
B101: G T C G C T – T A C G ? I G
B102: G C C G C T – T A C G ? I ?
B107: G T C G C T – T A G G ? I ?
B301: A T C G C T – T A C G ? I ?
B302: G T C G C T – T T C G ? I ?
Bx01: G T T G C T – T A C G ? I ?

Allèles O :
O101: G C C C C G – C A G G ? D G
O109: G C C C C G – C A G A ? D ?
O112: G C C C C G – C T G G ? D ?
O204: A C C C C G – C T G G ? D A
O207: G T C G C T – T A C G ? D A
O303: G C C C T G – C A C G ? I A



Il en découle que je suis O101 / O112 . Je savais déjà que j'étais du groupe O et ce n'était pour moi qu'une confirmation mais il est facile de voir que le génotypage, donne un résultat plus précis que seulement A, B , AB ou O.
Une analyse du même type est possible pour les groupes sanguins « non ABO » . Ces résultats sont faciles à collecter en même temps que les résultats ABO. On aboutit donc à la situation où l'analyse ADN permet de connaître en 1 étape rapide et fiable tous les groupes sanguins , il y en a une bonne trentaine dont beaucoup dont vous n'avez jamais entendu parler.
J'ai parlé de SNPs sans revenir explicitement à la méthodologie. Dans les typages qui précèdent on ne séquence PAS l'ADN de la personne même de façon partielle. C'est une puce ADN qui permet l'identification des allèles ; ces puces ADN sont bien adaptées à la détermination entre 2 allèles.

D'autres cas :

Le récepteur CCR5 est une protéine transmembranaire utilisée par le virus HIV (SIDA) lors de son cycle infectieux. On s'est aperçu qu'une fraction de la population européenne n'a plus de récepteur fonctionnel à cause d'une délétion dite « delta32 ». Les personnes porteuses de cette délétion sur les 2 chromosomes ne sont pas infectés par le virus HIV. C'est un caractère des européens du nord . On s'interroge sur la présence à un fort niveau d'une mutation inactivant CCR5 alors que le virus HIV n'existait pas préalablement.
Sensibilité aux dérivés coumaridiniques :
La coumaridine a longtemps été utilisée comme « mort-au-rat » à cause des hémorragies intestinales mortelles que ce produit provoquait. Il n'est peut être pas inutile de rappeler que les anti-coagulants comme la Coumadine / Warfarine très utilisés pour les personnes chez qui on craint la formation de caillots sanguins (cardiaques...) doivent être utilisés à des doses précises. Chez certaines personnes la dégradation du médicament est plus lente ce qui influe sur les dosages et on connaît des variants avec une sensibilité accrue aux coumaridiniques. La connaissances de la génétique va permettre un meilleur calibrage et éviter des tâtonnements pour trouver le bon dosage.
Le gène CYP2C9 est responsable de la vitesse de dégradation des coumaridiniques et on connaît 2 SNPs :
rs1799853=C ou T ; si T ou TT il y a ralentissement de la dégradation du médicament
rs1057910=A ou C ; si C ou CC il y a ralentissement de la dégradation du médicament
j'ai rs1799853=CC et rs1057910=AA , j'aurais donc (si je prenais de la Coumadine) une vitesse de disparition plutôt rapide.
Le gène VKORC1 est impliqué dans la production de Vitamine K, or la vitamine K est l'élément déterminant dans la formation d'un caillot sanguin. rs9923231=TT est une mutation induisant un taux réduit de production de vitamine K . J'ai ce caractère (et donc il me faudrait des doses faibles de Coumadine) et je dois dire que je ne m'étais jamais rendu compte que mon sang coulait plus que pour d'autres en cas de blessure. Il faut dire que l'alimentation peut apporter la vitamine K (légumes à feuilles vertes , etc...) et compenser.

La tolérance au lactose chez l'adulte :
Le lait contient un sucre, le lactose qui doit être scindé en glucose et galactose par l'enzyme lactase pour être digeste. Chez l'humain la lactase est présente chez le nouveau né puis elle disparaît. Cette situation, dite ancestrale, s'est modifiée avec l'apparition de l'élevage. Chez les européens une seule mutation est trouvée qui permet la persistance de la lactase à l'âge adulte : rs4988235=T (au lieu de C) . Un seul allèle T suffit : rs4988235=CT ou rs4988235=TT permettent de boire du lait à l'âge adulte sans être incommodé. D'un point de vue historique, comme on trouve d'autres mutations chez les peuples non européens c'est considéré comme un argument fort pour dire que cette mutation ne s'est produite qu'une seule fois et s'est répandue dans toute l'Europe (80% des européens porteurs).
Certaines personnes ont la surprise de se découvrir « intolérants au lactose ». J'ai donné cet exemple parce qu'il reflète un domaine encore immature mais en progression rapide qui est la compréhension de notre équipement génétique « dans la vie de tous les jours ».

Une compagnie comme 23andME utilise la puce ADN Illumina qui lui permet de tester 580 000 SNPs par analyse. En fait, pour l'instant seule une petite fraction de ces 580 000 résultats bruts est interprétable. Le génotypage va s'imposer au fur et à mesure et il est dommage que les possibilités de la génétique fassent peur en France.

Repost 0
Published by Didier
commenter cet article
2 août 2010 1 02 /08 /août /2010 21:23

 

Le texte «  ADN et généalogie : la généalogie génétique » complémente mon premier article sur la Généalogie génétique en montrant concrètement la démarche. Notamment, la possibilité d'interroger un cousinage grâce au test de 23andME (bien illustré !). C'est ce qui me fait conseiller ce test quand on me demande.

Je place ici quelques conseils pratiques. L'ADN mitochondrial ne donne d'information que pour le long terme et est rarement utilisable en généalogie. Un séquençage total de l'ADN mitochondrial est le seul test à considérer. Il faut savoir que dans un cas sur 5000 environ ce séquençage découvre une mutation sur un gène. Il vaut mieux ne publier le résultat qu'en connaissance de cause. Par rapport à ce que j'ai écrit dans le premier article, ceci est particulier à l'ADN mitochondrial. En moyenne une mutation intervient sur l'ADN mitochondrial tous les 3000 ans. Le lieu géographique des personnes ayant une correspondance exacte (exactement la même séquence, au nucléotide près) est « flou » à cause des mouvements de populations qui sont intervenus entre temps.

Pour l'ADN Y , un haplotype sur 67 marqueurs est requis pour comparer des cousins proches. En moyenne on attend une mutation toutes les 6 générations sur l'haplotype de 67 marqueur standard de Family Tree DNA , mais avec fluctuations, bien sûr. En analysant sur moins de marqueurs on risque d'avoir le même résultat pour tous les cousins et de ne rien pouvoir déduire.

Dans le texte qui suit , Bernard a bien expliqué comment l'analyse (SNP) sur puce ADN permet des comparaisons sur des cousins au 10 ème degré , au delà, seule l'analyse sur l'ADN Y permet de faire le lien entre la généalogie et le groupe d'origine (la « tribu ») définie de plus en plus finement par les marqueurs SNP (haplogroupe) et par l'haplotype. Bonne lecture.

 

Didier

 

 

 

 

 

ADN et généalogie : la généalogie génétique

 

 

Lors de la recherche de nos racines avec la généalogie traditionnelle, le témoignage des liens génétiques précis entre individus se perd définitivement avec l'absence de documents vers les années 1500-1600. Dès lors, il n'est plus possible de se poser la question : "qui a donné naissance à qui ? " .La question devient "qui est plus proche de qui ?" Avec des critères autres que ceux des noms de famille,la généalogie génétique grâce à l'analyse de l' ADN peut nous aider à approfondir nos connaissances sur nos ancêtres d'abord pour ceux des lignées paternelle et maternelle mais aussi pour ceux de toutes les autres branches de notre arbre généalogique .

Quel crédit accorder à ces nouvelles techniques ,avant d'investir trop d'espoir (et d'argent !) dans ces " tests " ADN ? Comme pour l'informatique,il faudra se familiariser avec des termes nouveaux ,mais une fois dans le bain il sera difficile de résister au jeu de poursuite de nos ancêtres!

 

 

 

1-L' ADN, lien intergénération

 

Les techniques de la médecine médico-légale ont impulsé une nouvelle approche de la généalogie traditionnelle .En effet dès 1996, le FBI a commencé à utiliser l' ADN pour identifier les auteurs de crimes .Depuis ,ces techniques de pointe d'identification génétique des individus sont utilisées pour la généalogie, pour la recherche de la filiation sans but médical ou légal .

Ces dernières années,la généalogie génétique a bouleversé notre perception de la proximité généalogique des êtres humains permettant de tester les liens de filiation entre des personnes,vivantes ou non ,car l'ADN raconte toute la richesse de notre histoire personnelle .

Cette nouvelle approche dans la recherche de ses ancêtres a fait fureur d'abord aux États-Unis car beaucoup d'américains ne sont pas de souche ,mais sont issus de la colonisation européenne: française,anglaise et hollandaise. Des firmes se sont spécialisées dans le créneau de la génomique ,par exemple 23andMe située dans la "Silicon Valley" de San Franscico,où se trouvent toutes les entreprises utilisant des technologies de pointe.

Il est désormais possible de reconstituer l'histoire lointaine d'une famille non plus en dépouillant les documents de l'état civil, et notariaux, mais en étudiant d'abord l'ADN du chromosome Y (ADN-Y)et celui des mitochondries (ADNmt),puis la technique ayant évolué, l'ADN des 23 paires de chromosomes humains .

La photo ci dessous,donne un aperçu de l'aspect des chromosomes contenu dans chaque cellule humaine. Il faut se rappeler que les chromosomes sexuels sont XYpour l'homme et XXpour la femme.

Chaque cellule contient aussi de nombreuses mitochondries ayant un ADN circulaire de très petite taille (non représenté ici ).

 

chromosomes.jpg

 

Figure 1: Les23 paires de chromosomes d'un homme

2-Sur mon arbre....deux branches se développent

 

Des nouveaux critères génétiques ont été établis par les généticiens des populations grâce aux particularités de l'ADN découvertes par les biochimistes .

Les ADN-Y et ADNmt sont des outils puissants car ils élaguent notre arbre généalogique en ne développant que les deux branches externes , celle de la lignée patrilinéaire ,correspondant à la transmission du chromosome Ydu père à ses fils . L'autre branche ,celle de la lignée matrilinéaire,correspond à la transmission des mitochondries ,donc de l' ADNmt par la mère à tous ses enfants. Cet élagage simplifie dans un premier temps l'étude de notre passé ,mais en restreint le champ. Cependant ,c'est la première étape des analyses lorsque l' on démarre les "tests" ADN.

 

crobar-arbre.jpg

 

Image modifiée tirée de 23andMe

 

Figure 2 :Retrouver des ancêtres sur les deux rameaux externes

 

Le travail du généalogiste ne fait que commencer quand il reçoit par e-mail les résultats de ses premiers tests.Il est aidé par les laboratoires qui lui envoient la liste des personnes ayant le même profil génétique que lui .Cela signifie qu'il y a des liens de parenté ,donc un ancêtre commun .Si l'ancêtre commun est proche (jusqu'à 10 générations),il y a échange des Gedcom. Au delà (20-50 générations) on va regarder l'origine géographique de toutes les personnes ayant le même profil. Si sur 10 personnes comparées,la majorité est d'origine méditerranéenne, cela veut dire que tous ont un ancêtre commun ayant vécu il y a 1000 ans ou plus dans cette région.

Ainsi va commencer la traque de ses ancêtres .Cette démarche repose sur le travail des généticiens qui,après analyse de l'ADN du chromosome Ydes hommes de toutes les régions du monde, ont conclu que tous les hommes de la lignée patrilinéaire vivant aujourd'hui descendent d'un seul homme qui a vécu en Afrique il y a 60.000 ans environ .C'est l'Adam Y.

De même ,suite au travail des généticiens , Il a été établi l'existence de plusieurs Eves mitochondriales.

Selon la théorie "out of africa" on considère que le début de l'humanité a commencé en Afrique puis une première migration hors de l'Afrique,suivie par d'autres sur toute la terre.

Ces études ont permis de comprendre la longue marche de l'évolution de l'homme rythmée par de nombreuses mutations de l'ADN. Celles ci vont permettre de suivre et de dater la naissance de nouvelles lignées humaines dont le déplacement pourra être traqué , à la surface de la Terre grâce aux types de mutations observées. On a pu dater de cette manière la disparition des néandertaliens ,en Europe ,il y a 30000 ou 40000 ans.

L'ADN humain se modifie continuellement à cause de mutations survenues depuis l'émergence de l'homme sur la terre.Le tic-tac de l'horloge moléculaire est rythmé par les mutations depuis l' AdamYet l'Ève mt .

L'ADN peut se lire comme une sorte de calendrier où est inscrite l'histoire des origines de l'homme, comme celle des migrations, des invasions et des peuplements.

Les différentes mutations de l'ADN sont utilisées comme les aiguilles du cadran d'une horloge pour calibrer le temps.

- la trotteuse des secondes (taux de mutation rapide) permet l'analyse d'un passé récent
- l'aiguille des minutes (taux de mutation à vitesse moyenne) pour l'analyse d'un passé proche: des centaines d'années.
- l'aiguille des heures (taux de mutations à vitesse lente ) pour l'étude d'un passé lointain: des milliers d'années.

 

3-Recherchede cousins dans tout l' arbre généalogique

 

En utilisant l'ADN des autosomes (voir fig 1), c'est à dire la majeure partie de notre ADN ,on pourra remonter les lignées des quatre grands-parents alors que précédemment ,on ne s'intéressait qu'à deux (la mère de la grand mère maternelle,etc..et le père du grand père paternel,etc...). Ainsi en remontant jusqu'à 10 générations, au lieu de ne trouver que deux ancêtres des lignées paternelle et maternelle, on pourra grâce à l'ADN retrouver théoriquement la trace de 1024 ancêtres avec leurs descendants,dans la mesure où bien sûr, on arrive à trouver des apparentés grâce aux analyses de l'ADN effectuées chez un grand nombre de généalogistes.

 

arbre-genealogique.jpg

 

 

adapté de Wikipedia

Figure 3: Arbre familial simplifié

( relations de chaque personne avec la personne en orange; les cousins correspondent aux cases vertes )

 

Voici comment dans les trois exemples suivant se visualisent les résultats de comparaison des ADN entre des apparentés ayant un ancêtre commun proche ou de plus en plus lointain. Cela se traduit visuellement par un nombre de segments d'ADN partagés décroissant lorsque le degré de parenté devient plus éloigné. Dans le cas de la figure 4 où les deux personnes sont cousins au 7ème degré ,on a plus qu'un seul segment commun sur le chromosome n°10.

 

Comparaison1.jpg

 

 

Figure 4: Fragments d'ADN identiques(en bleu)

 

( Chaque barre horizontale représente un chromosome schématique numéroté de 1 à 22,avec X et Y)

 

comparison2.jpg

 

Figure 5 : un seul fragment d'ADN identique trouvé

 

4- Mosaïque de populations constituant chaque arbre généalogique

 

On a vu que dans un arbre généalogique on a 1024 ancêtres possibles à la 10ème génération. Si l'on remonte à 70 générations ,c'est à dire à la période romaine ,ce nombre serait énorme. On peut imaginer pour une personne dont l' ADN est 100% européen que, au gré des mouvements de populations, des guerres, des invasions d'origines très diverses,son arbre généalogique soit très hétérogène dans la composition de l'origine géographique de ses membres.

Notre arbre généalogique qui peut donc s'étendre sur plusieurs milliers d'années doit être une mosaïque d'ancêtres issus d'un grand nombre de populations ,de tribus, de peuples ,peuplades provenant des 4 coins de l'Europe depuis la préhistoire.

Une compagnie américaine DNA Tribesest spécialisée dans la détermination de l'origine géographique de nos ancêtres,grâce à l'ADN .Leur analyse localise les populations actuelles où la concordance de notre profil génétique est la plus élevée,car nos ancêtres y ont absorbé une partie de leurs caractéristiques génétiques ,transmises jusqu'à nous. Donc,il est possible de connaître de quelles régions de l'Europe proviennent majoritairement nos ancêtres ,de l'Europe du sud,des régions celtiques et germaniques,du sud de l'Italie Sicile ,Grèce et Turquie et des régions slaves par exemple.

DNA Tribes grâce àson analyse génétique apporte en plus à la généalogie traditionnelle de nouvelles informations qui peuvent être exploitées pour compléter nos recherches généalogiques.

 

5-Conclusion

 

Cette nouvelle approche de la généalogie totalement innovante peut surprendre car elle permet de trouver des relations de parenté très lointaines et de connaître quelles peuplades ont pu contribuer à notre arbre généalogique .Grâce à la généalogie génétique ,on peut explorer son arbre généalogique dans des périodes proches ou très lointaines à trois niveaux : approfondissement des lignées patrilinéaire et matrilinéaire,recherche de cousins dans toutes les branches et recherche de la mosaïque des peuples prédominants dont nous sommes issus.

C'est un domaine en progression constante . Aussi , une fois familiarisé(e) avec ces nouveaux concepts et grâce à la facilité de communication qu'offre internet, il est possible de dialoguer avec les cousins potentiels, de progresser grâce à la lecture assidue des forums ,DNA Forums ,,dont une partie est en français.Au bout de quelques mois, de nouveaux horizons généalogiques vont s'ouvrir avec un réseau de cousins. Une nouvelle vision de notre généalogie va se dessiner ,avec peut-être des découvertes surprenantes. Bon voyage!

 

Bernard Béguet

 

 

Repost 0
Published by Didier
commenter cet article
1 août 2010 7 01 /08 /août /2010 14:45

 

Généalogie génétique, cette association est nouvelle et consacre l'émergence d'une nouvelle discipline. Il y a 2 pôles : la compréhension du peuplement actuel en liaison avec la théorie "Out of Africa" (discussion à suivre) qui met en jeu les marqueurs dits SNP (Single Nucleotide Polymorphism) , et le prolongement de la recherche généalogique, là où les documents écrits viennent à manquer, par des comparaisons génétiques qui mettent en jeu les marqueurs dits STR (Short Tandem Repeats) ; c'est cette dernière facette, la plus pratiquée par le grand public, qui donne le nom de Généalogie génétique. Ceci dit, le développement en France reste confidentiel si on compare aux pays anglo-saxons et c'est un problème car les résultats intéressants sont directement proportionnels à la taille de la banque de donnée qui permet les comparaisons d'haplotypes (définition à suivre).

 

1 – Le modèle « Out of Africa » - principe de l'utilisation du chromosome Y

 

Le chromosome Y est particulier car il n'est présent qu'en 1 seul exemplaire et seulement chez les hommes (qui ont XY comme chromosomes sexuels, alors que les femmes sont XX). Il a été montré que sur une grande partie ce chromosome Y ne recombine pas avec le chromosome X , alors que, par exemple , le chromosome X va être l'objet de recombinaisons entre les 2 copies présentes chez les femmes. Donc le chromosome Y est transmis de père en fils , un peu comme un bâton de relais et c'est le seul chromosome dans ce cas puisque de nombreux mélanges (recombinaisons) ont lieu sur les autres chromosomes. Ceci dit des mutations peuvent se produire ; le suivi de ces mutations va permettre d'identifier des groupes humains ayant les mêmes mutations sur le chromosome Y et cette approche est en train de révolutionner notre compréhension de l'histoire de l'homme.

Que sont ces mutations qui sont suivies sur le chromosome Y ? On distingue 2 types de mutations et, pour l'instant nous ne nous intéresserons qu'aux mutations ponctuelles dites SNP. Une mutation ponctuelle sur le chromosome Y a peu de chances de modifier une fonction vitale et celles utilisées sont des mutations neutres ne modifiant le produit d'aucun gène. Dans ce qui suit il ne faut donc pas envisager que les mutations invoquées ont un effet repérable : ce sont des marqueurs génétiques et donc uniquement des moyens de comparer des populations. Une mutation ponctuelle ne se produit que rarement et il est très peu probable que la même mutation se produise dans 2 lignées . Donc une même mutation va repérer des hommes ayant eu une origine commune.

 

Je prends comme exemple le marqueur M168 : tous les hommes issus de populations non africaines ont cette mutation et seuls certains groupes africains ne l'ont pas ; ce sont, par exemple, les Pygmées et les Bushmen . On a déduit de cette situation que Homo sapiens a d'abord été africain. M168 nous dit que la sortie d'Afrique a été le fait d'un groupe d'hommes ayant cette mutation : c'est le modèle « Out of Africa » . La sortie d'Afrique en question serait la dernière vague, celle de l'homme actuel et ceux ci ont pris la place des populations homo précédentes. Le point important est que cette sortie d'Afrique est relativement récente – environ 70 000 ans. Pour ceux qui souhaitent approfondir voici quelques informations sur la façon dont on caractérise une telle mutation. Toute mutation identifiée reçoit un premier « nom » , dans ce cas rs2032595. Cette mutation lorsqu'elle a été citée pour « out of Africa » a reçu un nom usuel : M168 .

M168 = rs2032595 C--> T position 13323385

Ce qui précède se lit : M168, initialement rs2032595 à la position 13323385 sur le chromosome Y ; il y a normalement un C ( Cytosine) , situation ancestrale, et ceux ayant la mutation M168 ont un T (Thymine) à la place du C. On pourrait penser que la situation la moins fréquente (Pygmées) est la situation « mutée » et qu'il faudrait inverser la lecture. Il y a encore des débats sur ce point mais l'arbre génétique qu'on peut déduire de l'ensemble des mutations connues et la comparaison avec le génôme du Chimpanzé vont dans le sens de lecture « Out of Africa » : les Pygmées et les Bushmen ont conservé l'ADN ancestral et les autres populations descendent du groupe « mutant » , sans doute porteur d'un progrès technique qui a permis cette sortie d'Afrique .

 

 

2- L'ADN mitochondrial comme outil pour la génétique :

 

Les mitochondries présentes dans le cytoplasme de nos cellules (hommes et femmes) contiennent un ADN circulaire de 16570 nucléotides, donc beaucoup plus petit que le chromosome Y mais c'est suffisant pour les études génétiques et, dans un premier temps, cette petite taille a facilité le travail des scientifiques ; c'est ainsi que les premiers résultats ont été obtenus sur l'ADN mitochondrial. Il se trouve que les mitochondries ne sont pas transmises par les spermatozoïdes ; les mitochondries des cellules de nos enfants sont celles de leur mère. Nous avons tous des mitochondries et nous les avons hérité de notre mère. La transmission mère fille de l'ADN mitochondrial permet d'analyser les populations de la même façon que dans le cas de la transmission père fils avec le chromosome Y. Le modèle Out of Africa se trouve conforté par le fait que les groupes L0 , L1 et L2 sont africains alors que toutes les autres populations sont des descendants (sous groupes) du groupe L3. On peut imaginer un groupe humain porteur d'un ADN-Y avec la mutation M168 et un mtDNA L3 dont la plupart des groupes humains actuels sont issus. Il est aujourd'hui possible de séquencer entièrement l'ADN mitochondrial et c'est la seule bonne façon de comparer. Une compagnie propose à des prix acceptables un tel séquençage pour des particuliers. L'ordre de grandeur est de 10 000 mtDNA dans le monde séquencés, et donc une base de données qui est maintenant très convenable.

 

 

3- L' Abre Y :

 

Y

•       A   M91 Afrique

•       BT    SRY10831.1

•      •       B   M60 Afrique

•      •       CF    M168

•      •       •      DE    YAP

•      •       •      •       D    M174 Tibet, Japon

•      •       •      •       E     M40 Afrique du nord , Afrique noire , Moyen orient

•      •       •      C,F   P143

•      •       •      •       C    M130 Asie (Mongolie) , Polynésie, Australie

•      •       •      •       F     M89

•      •       •      •      •       G     M201 Caucase, Europe , moyen orient

•      •       •      •      •       H    M69 Inde (+ Gitans)

•      •       •      •      •       IJK    M523

•      •       •      •       •      •       IJ   M429

•      •       •      •       •      •       •       I     M170 Europe

•      •       •      •       •      •       •       J     M304 Moyen orient , Europe

•      •       •      •       •      •       K     M9

•      •       •      •       •      •       •       L     M11 Inde

•      •       •      •       •      •       •       MNOPS    M526

•      •       •      •       •      •       •      •       M    P256    Nouvelle Guinée

•      •       •      •       •      •       •      •       NO    M214

•      •       •      •       •      •       •      •       •       N     M231 Sibérie , Finlande

•      •       •      •       •      •       •      •       •       O     M175 Asie (extrême orient - riz)

•      •       •      •       •      •       •      •       P     M45

•      •       •      •       •      •       •      •       •       Q     M242 Amérique

•      •       •      •       •      •       •      •       •       R     M207 Europe , Asie (Iran)

•      •       •      •       •      •       •      •       S    M230 Mélanaisie , Nouvelle Guinée (Papous)

•      •       •      •       •      •       •       T     M70 Afrique de l'Est, Inde , Europe

 

 

Toutes les mutations ont un nom usuel comme M168 car elles sont régulièrement citées comme marqueurs des groupes de cet arbre. M168 discutée ci-dessus apparaît à la ligne 4 pour définir le groupe [CF]. Les groupes A , [BT] et B sont uniquement africains. Le groupe [BT] est ancestral au groupe [CF] et donc la mutation SRY10831.1 est commune . En dessous de [CF] il y a deux cas :

  •  
    • le groupe [DE] se caractérise par un élément d'insertion « Alu » nouveau sur Y

    • les groupes C et F ont tous deux la mutation P143 en commun

Je ne vais pas décrire tout l'arbre. Les populations européennes sont principalement formées de sous groupes de F mais le groupe E est très répandu (venu d'Egypte) sur le pourtour méditerranéen , les Kabyles et de nombreux groupes arabes sont du groupe E . Comme le montre l'arbre pour le groupe F , on distingue plus précisément les grands groupes G , H et [IJK] ; ce dernier groupe se subdivise à son tour en I , J et K. Le groupe majoritaire en Europe de l'ouest est le groupe R descendant du groupe K et tous ceux du groupe R portent les mutations : M168, P143, M89, M523, M9, M526, M45 et M207 . La succession de ces mutations retrace , en quelque sorte, le périple génétique qui a mené au groupe R ; j'emprunte cette notion à Spencer Wells (« genetic journey ») créateur du projet Genographic. On a donc l'identification de groupes qu'on nomme haplogroupes car ils sont définis sur la base d'un seul chromosome (dans ce cas le chromosome Y) et ces groupes ont une répartition géographique en rapport avec les liens génétiques que révèle l'arbre, en général. Il y a quelques cas qui pose question : le groupe D qui partage avec le groupe E la présence du marqueur YAP est un groupe qu'on rencontre du Tibet au Japon ; le lien avec le groupe E fait supposer que le groupe DE originel était asiatique et que le groupe E a effectué un retour vers l'Afrique de l'Est mais ce point fait l'objet de discussions.

L'arbre ci-dessus retrace à grands traits les séparations qui ont jalonnées l'histoire de l'homme de ces 70 000 dernières années. Il est possible d'être plus précis : le groupe R se subdivise à son tour selon de nombreuses mutations (SNP) ; je ne détaille pas ici mais le groupe le plus fréquent en France est repéré par M168, P143, M89, M523, M9, M526, M45 et M207 (ceux là caractérisent R) , M173, M343, P25, P197, M269 (ces 5 mutations précisant le sous groupe R1b1b2) , L23, L51, L52, P310, P312, L21 (c'est un exemple – il y a d'autres sous groupes). On a donc une vingtaine de mutations

dont la succession (dans l'ordre où je les ai écrites) a conduit au groupe actuel . De nouveaux SNPs permettant de décrire plus finement les groupes (haplogroupes) continuent d'être identifiés.

 

4- Comment ces résultats ont-ils été obtenus ?

 

Les populations peuvent donc être réduites aux tribus dont nous sommes issus et l'organisation des SNPs en arbre permet de retrouver les filiations des groupes entre eux. Ces résultats ont été obtenus premièrement par les scientifiques et par tous les résultats accumulés des particuliers collectés dans des bases de données publiques. Je n'ai pas de contrat pour faire de la pub mais c'est un fait (souvent ignoré en France) que 2 compagnies font ces tests avec la qualité et la précision des laboratoires de recherche : Family Tree DNA (Igenea en Europe) et 23andME . Il y a 2 méthodologies différentes . Family Tree DNA amplifie la région du chromosome Y à analyser et et en établit la séquence ; on voit ainsi s'il s'agit de la séquence ancestrale ou de la forme mutée, il faut refaire une amplification et un séquençage à chaque fois qu'on veut tester un autre SNP. 23andME analyse avec une puce à ADN qui teste d'un seul coup tous les SNPs pour laquelle la puce a été prévue, donc tout l'arbre de tous les SNPs est obtenu en une étape ; c'est mieux mais un peu plus cher.

 

Tout un chacun peut ainsi connaître sa lignée paternelle et son origine. Il ne s'agit que d'une seule lignée parmi tous nos ancêtres . Cette approche se révèle très instructive au niveau des populations et la participation de particuliers a permis de « booster » ce champ de recherche. En France où nous avons très peu de tests faits par des particuliers nous n'avons pratiquement pas d'études SNPs, avec la précision que permettent 23andME ou Family Tree DNA , disponibles publiquement.

 

 

 

5- Les principaux groupes en France

 

On a quand même quelques informations sur les haplogroupes en France. Le groupe de G. Lucotte a été pionnier dans les études génétiques des populations mais ils utilisaient une analyse RFLP avec une sonde p49a,f qui n'est plus pratiquée aujourd'hui. On a donc une analyse, pas aussi fine que ce que permettent les SNPs connus maintenant mais quand même solide. Il y a les Canadiens français qui, eux, se font tester et les familles émigrées aux USA. On connaît donc, en gros, les groupes les plus importants en France ; on connaît moins les différences régionales. Par exemple on ne sait pas si la Normandie garde la trace des colons Normands (Vikings) et leur fréquence.

 

Les études portent, en général, sur des échantillons de personnes ayant une origine connue dans la région étudiée. Le groupe principal en France (environ 55% des hommes) est R1b1b2 discuté plus haut, groupe dont on connaît plusieurs sous groupes. L'haplogroupe I (la lettre i) est européen et on connaît 2 grands sous groupes I1 et I2 , anciennement séparés. Les 2 formes existent en France et la fréquence combinée des deux est autour de 15% . Je ne me risque pas à décrire la répartition entre les autres haplogroupes.

 

6- Les marqueurs STR

 

Les marqueurs STR (pour Short Tandem Repeat) sont connus en France sous le nom d'empreintes génétiques. Ce sont ces marqueurs qui permettent les identifications policières si souvent vues dans les séries à la télé et aussi dans la réalité. On trouve ces marqueurs sur tous les chromosomes et il y en a sur le chromosome Y ; ce sont ces derniers qui seront exclusivement utilisés pour conforter les analyses SNPs. Ce sont les mêmes marqueurs qui sont utilisés, par exemple, pour les recherches de paternité. Cette situation crée une ambiguïté regrettable sur la motivation d'un test STR .

Le marqueur DYS393 sera pris ici comme exemple ; voici comment se présente la séquence ADN au niveau du marqueur DYS393 (rappel le code ADN est la succession des 4 bases notées A, G, C et T) :

 

atacagatagatagatagatagatagatagatagatagatagatagatagatagatatgtatgt

 

ataca [gata]13 tgtatgt

 


La séquence ci-dessus montre une région formée par la succession de [gata] (13 répétitions). Dans l'exemple ci-dessus il y a 13 motifs [gata] qui se suivent « en tandem » d'où le nom que les anglo-saxons donnent à ces empreintes génétiques.  On observe que d'une génération à l'autre il peut y avoir perte où gain d'un motif [gata] et un tel changement se produit bien plus fréquemment qu'une mutation SNPs. C'est donc le nombre de répétitions du motif [gata] qui est repéré. La grande majorité des utilisateurs ne connaissent pas le motif des marqueurs qu'ils utilisent ; ce qui compte c'est le nombre de motifs.  Les taux de mutation ne sont  pas les mêmes. Il y a des marqueurs qui mutent très souvent (une fois toutes les 10 générations, par exemple) et des marqueurs qui mutent presque comme des marqueurs SNPs. Donc on mesure le nombre de répétitions et, dans l'exemple ci-dessus on note :  DYS393=13  et ainsi de suite pour les autres marqueurs . Le résultat combiné  de tous  les comptes de répétitions est un haplotype. C'est un peu comme un code barre avec une valeur (le nombre de motifs) pour chaque marqueur. Plus il y a de marqueurs plus l'haplotype sera spécifique. Il y a des banques de données  de ces haplotypes. Au sein d'un même haplogroupe les haplotypes seront semblables et cela permet de prédire l'haplogroupe à partir de l'haplotype (avec une incertitude – mieux vaut une véritable mesure) , par comparaison. C'est aussi la variabilité des haplotypes dans un groupe qui donne une mesure de « l'âge » du groupe. On dispose donc d'une panoplie d'outils qui permettent de bien appréhender les groupes humains par le biais de l'ADN-Y . Si le séquençage total de génôme progresse on pourra comparer des chromosomes Y en décuplant les marqueurs pour les comparaisons.

 

Repost 0
Published by chezdidier.over-blog.com
commenter cet article